You are here

El Origen de la Vida

Ramón Gómez, Graduado en Matemáticas y Teología

¿Cómo se originó la vida en la Tierra? ¿Fue debido a causas naturales o a la acción de un creador? ¿Es la vida resultado del diseño o de la evolución? ¿Qué nos dice la evidencia científica?

El Método Científico: Observación e Hipótesis

Puesto que el método científico se basa en la observación, para proponer una hipótesis científica sobre el origen de la vida debemos primeramente definir qué es un ser vivo y observar detenidamente cuáles son sus características.

A continuación nos preguntaremos cómo llegaron a existir estas características que la vida posee. En otras palabras, la ciencia construye sus hipótesis basándose únicamente en las características observadas.

¿Qué es la vida? Sistemas, Reproducción e Información

La vida se sustenta en sistemas biológicos que se reproducen en base a la información codificada en su genoma. Por lo tanto cualquier explicación sobre la causa que provocó el origen de la vida debe explicar el origen de sus sistemas, de su reproducción y de su información genética.

1. Sistemas Biológicos

Los seres vivos son sistemas biológicos porque están compuestos por múltiples elementos que cooperan entre sí para conseguir un fin que no podrían alcanzar por separado.

2. Reproducción

Los seres vivos surgen por reproducción, es decir, proceden de individuos que poseen la capacidad de hacer copias de sí mismos. Todos los seres vivos se originaron en organismos dotados de sistemas reproductivos que les capacitan para dejar descendencia.

3. Información

Los seres vivos se generan a partir de la información genética. Esta información está almacenada en una molécula llamada ADN en el interior de la célula. El ADN contiene todas las instrucciones necesarias para fabricar una copia del organismo. En el momento de la reproducción el organismo lee y ejecuta de forma automática estas instrucciones previamente programadas en su ADN.

Hipótesis Científicas sobre el Origen de la Vida

¿Cómo se originaron estos sistemas que se reproducen ejecutando instrucciones previamente codificadas en una molécula?

Una hipótesis científica del origen de la vida debe explicar el origen de estas características que observamos en los seres vivos. ¿Son estas características el resultado de la acción de un Diseñador Inteligente o de la acción de fenómenos naturales? ¿Qué causa tiene la capacidad de producir sistemas biológicos que se reproduzcan usando información codificada?

Hipótesis Naturalista: La Evolución Química

El naturalismo es un sistema filosófico y de creencias que sostiene que no existe nada fuera de la naturaleza y que la naturaleza no muestra evidencias de haber sido creada.

El naturalismo es un sistema de creencias que explica el origen de la vida mediante hipótesis científicas tales como la Evolución Química, la Abiogénesis o la Generación Espontánea. Estas teorías postulan que los primeros seres vivos surgieron espontáneamente a partir de la materia inerte por causas puramente naturales. Eso implica que de alguna forma la materia, dejada a sí misma, se transformó en sofisticados sistemas biológicos capaces de reproducirse usando información, es decir instrucciones de montaje, codificada previamente en una molécula.

Ante la propuesta naturalista deberíamos ser honestos y preguntarnos: ¿Es biológicamente posible que la materia inerte se transforme por sí misma en seres vivos, es decir en sistemas biológicos capaces de reproducirse usando la información codificada digitalmente en su genoma?¿posee la materia inerte capacidad de transformarse por sí sola en seres vivos?

Hipótesis Creacionista: El Diseño Inteligente

El creacionismo es un sistema filosófico y de creencias que sostiene que la creación es evidencia científica del creador.

El creacionismo es un sistema de creencias que explica el origen de la vida mediante una hipótesis científica denominada Diseño Inteligente. Esta teoría postula que ciertas características observadas en los seres vivos se explican mejor por la acción de un agente inteligente que por causas naturales. En concreto la existencia de sistemas que se reproducen usando información, es decir instrucciones de montaje, previamente codificada en una molécula indica un origen inteligente porque la única causa capaz de codificar instrucciones digitalmente es la inteligencia.

Ante la propuesta creacionista deberíamos ser honestos y preguntarnos: ¿Cuál es la causa más probable para el origen de los seres vivos? ¿Qué causa tiene la capacidad de originar sistemas que se reproducen en base a instrucciones previamente codificadas?

Este artículo presenta una reflexión que nos ayudará a descubrir si la hipótesis de la generación espontánea de la vida tiene base científica sólida o si es una mera especulación.

Para reflexionar sobre el origen de la vida vamos a observar uno de los organismos más simples que existen: la bacteria.

EL ORIGEN DE LOS SISTEMAS BIOLOGICOS - MAQUINAS MOLECULARES

Organismos

Los seres vivos más complejos realizan sus funciones mediante sistemas (nervioso, muscular, óseo,...) y aparatos (circulatorio, digestivo, reproductor, ...). Estos sistemas y aparatos están compuestos por órganos (cerebro, corazón, intestinos, ...) y los órganos a su vez están formados por tejidos (muscular, óseo, nervioso,...). Los tejidos están compuestos por células.

Las células son la unidad básica de la vida y en su interior se desarrolla toda la actividad necesaria para que un organismo pueda vivir y reproducirse.

Incluso los organismos más simples, como por ejemplo las bacterias, poseen una infinidad de elementos que cooperan entre sí con el propósito de sustentar la vida. Los organismos unicelulares, al igual que los pluricelulares, están formados por una multitud de sistemas biológicos que se reproducen usando información genética.

Toda la actividad necesaria para la vida, la reproducción, la información y los sistemas biológicos, tiene su origen en el interior de la célula. La clave de conocer el origen de la vida está en la célula.

Máquinas en el interior de la célula

Los científicos han descubierto que las células son verdaderas fábricas en miniatura capaces de hacer copias de sí mismas. Al igual que en una fábrica la actividad dentro de la célula se lleva a cabo mediante pequeñas máquinas en miniatura.

El interior de la célula es un mundo fascinante y sofisticado en el que descubrimos una gran cantidad de robots en miniatura denominados máquinas moleculares. Estas máquinas son las que llevan a cabo incesantemente todas las tareas necesarias para sustentar la vida.

La revista Cell publicó en Febrero de 1998 un número monográfico dedicado a las máquinas moleculares. Los títulos de algunos de sus artículos son muy significativos: "La célula como colección de máquinas proteínicas..", "Polimerasas y Replisoma: máquinas dentro de máquinas", "Aparatos Mecánicos del Spliceosoma: Motores, Relojes, Muelles, y Cosas"

En el mismo número Bruce Alberts, Presidente de la Academia Nacional de Ciencias de los EEUU, escribió...

“¿Por qué denominamos máquinas proteínicas a los grandes complejos proteínicos que subyacen bajo las funciones celulares? Precisamente porque, al igual que las máquinas inventadas por humanos para funcionar en el mundo macroscópico estos complejos proteínicos contienen partes que se mueven con un alto grado de coordinación”

Cell , Vol. 92, 291–294, Issue 3, February 6, 1998

El Motor del Flagelo Bacteriano

Las bacterias son microorganismos unicelulares muy pequeños. La bacteria E. Coli suele medir alrededor de 2 μm (0.002 mm) de longitud. Es decir que se requieren 500 bacterias para completar un milímetro (un milímetro es el grosor de la raya de un lápiz). La bacteria E. Coli suele pesar 1 picogramo (0.000 000 000 001 gramos). Es decir que se requieren 1 billón (un millón de millones) de bacterias para pesar un gramo.

La bacteria E. Coli es capaz de propulsarse en un medio líquido gracias a unos filamentos denominados flagelos. Recientemente los bioquímicos han descubierto que estos filamentos poseen en su base motores. Los científicos han descubierto que la bacteria E. Coli está dotada de un conjunto de motores fuera borda.

Cada motor es una maravilla de la ingeniería a escala miniaturizada, que posee las siguientes características:

* Proporciona una velocidad de 35 veces la longitud de su cuerpo por segundo.1 A escala humana esto equivaldría a un ser humano capaz de nadar a 60 metros por segundo, es decir a más de 200 kilómetros por hora sin fatigarse nunca.

* Funciona bajo un ciclo rotatorio semejante al motor Wankel usado por el modelo Mazda RX-8 o a la turbina de una central nuclear.

* Usa energía protónica como combustible.

* Es bidireccional y puede cambiar el sentido de giro en 1/4 de vuelta.

* Es capaz de alcanzar una velocidad de giro de 100.000 revoluciones por minuto, es decir más de 1.500 revoluciones por segundo.

* Tiene una conexión fija con un mecanismo transductor o detector de señales que retiene información del medio en el que se encuentra.

También se ha descubierto que el motor bacteriano posee los siguientes componentes:

* Estator.

* Rotor.

* Cojinetes.

* Una articulación en U.

* Eje propulsor.

* Hélice.

Howard Berg, de la Universidad de Harvard, en sus conferencias se refiere a este motor como "la máquina más eficaz del universo".

La Kinesina

Las células contienen una gran cantidad de componentes especializados que realizan funciones vitales para su existencia. Pero ¿cómo llegan estos componentes al lugar de la célula que les corresponde para desempeñar sus funciones? Para los componentes de mayor tamaño se necesita un sistema de transporte; la kinesina.

La kinesina es una de las muchas obras maestras de micro ingeniería descubiertas en la célula. Las kinesinas son motores moleculares, verdaderos motores en miniatura que transportan componentes de un lugar a otro en la célula caminando a lo largo de unas pasarelas autoensambladas llamadas microtúbulos. Se la ha denominado la bestia de carga de célula. Poseen dos “pies” o cabezas globulares que literalmente caminan, un “pie” tras otro, a lo largo de los microtúbulos arrastrando su carga hacia su destino.

Cada uno de sus “pies” posee dos lugares especiales llamados centros de unión que interactúan con otras moléculas, un centro de unión se acopla con el microtúbulo y el otro con una molécula de ATP, la molécula de energía de la célula. Cuando uno de los pies se une con la molécula de ATP y utiliza su energía el pie salta hacia adelante produciendo el movimiento de caminar.

Cada "pie" tiene un cuello corto que está conectado a una hebra semejante a un bastón enrollado que termina en una estructura con forma de abanico que sirve para sujetar la carga que se transporta. La kinesina avanza 100 pasos cada segundo en los cuales recorre una distancia de 8 μm.

El Motor ATP

El ATP es una molécula que posee la capacidad almacenar gran cantidad de energía. Todos los seres vivos usamos esta forma de energía para hacer funcionar los mecanismos fisiológicos de nuestro organismo. Sin el ATP nuestras células morirían, y nosotros con ellas.

La molécula ATP es fabricada por un motor en miniatura llamado ATP sintasa. El ATP sintasa es una de las maravillas del mundo molecular, una sorprendente máquina en miniatura. Es un generador de energía micro-molecular de alta tecnología. Funciona como un motor rotatorio y consta de 32 componentes o piezas que trabajan en de forma coordinada para producir y almacenar energía. El motor ATP sintasa usa como “combustible” un flujo de protones. Posee muchas piezas similares a las usadas en las tecnologías diseñadas por los hombres como por ejemplo un rotor, un estator, un eje de trasmisión, etc.

CONCLUSIONES SOBRE LAS MAQUINAS MOLECULARES

Algunas máquinas funcionan como un tren de mercancías transportando incesantemente materiales de construcción o desecho allí donde hacen falta, usando unos canales que forman la red ferroviaria de la célula. Existen cables moleculares, poleas, máquinas movidas por impulsos luminosos que utilizan partículas de luz y las almacenan en baterías moleculares. Existen máquinas que activan interruptores, máquinas que envían impulsos eléctricos a los nervios, máquinas que construyen otras máquinas, máquinas que se construyen a sí mismas, máquinas que nadan, máquinas que copian información, máquinas que ingieren y digieren, motores, propulsores, rotores, transportadores, generadores eléctricos, etc..

El genetista neozelandés Michael Denton escribe:

“La biología molecular ha mostrado que hasta los más sencillos de todos los sistemas vivientes en la Tierra hoy, las células bacterianas, son objetos tremendamente complejos. Aunque las células bacterianas más diminutas son increíblemente pequeñas, y pesan menos de 10-12g, cada una es en realidad una verdadera fábrica microminiaturizada que contiene miles de piezas exquisitamente diseñadas de intrincada maquinaria molecular, compuesta en total de cien mil millones de átomos, mucho más complicada que cualquier máquina construida por el hombre y absolutamente sin paralelo en el mundo inanimado”

Evolution: A Theory in Crisis, pág. 250.

EL ORIGEN DE LA REPRODUCCIÓN - LA CONSTRUCCIÓN DE LAS MÁQUINAS MOLECULARES

Una célula se reproduce haciendo una copia de sí misma. Eso implica que la célula hija necesita equiparse de toda las maquinas necesarias para llevar a cabo sus funciones, por ejemplo necesitará equiparse de motores para poder desplazarse posteriormente. La reproducción implica, entre otras cosas la construcción de toda la maquinaria molecular que la célula necesita para realizar sus funciones.

¿Cómo obtienen las células sus máquinas moleculares?

Los seres humanos cuando nos proponemos fabricar una máquina lo hacemos ensamblando todas las piezas que la componen. Este mismo proceso tiene lugar dentro de la célula.

Las máquinas moleculares están compuestas de diminutas piezas denominadas proteínas. ¿Cómo se originan estas piezas y cómo se ensamblan para formar motores?

Fabricación de las piezas una a una

Los bioquímicos descubierto que las células fabrican sus máquinas elaborando pequeñas piezas (proteínas) y ensamblándolas formando sofisticados mecanismos compuestos de miles de piezas que encajan perfectamente las unas con las otras. Las piezas son fabricadas en distintos lugares de la célula y posteriormente son transportadas al lugar en el que la célula está construyendo su motor.

Uso de herramientas para construir los motores

Los seres humanos construimos motores con la ayuda de herramientas. Las células usan también distintas herramientas para fabricar sus motores. La bacteria E. Coli usa una máquina denominada aparato de exportación flagelar cuya función consiste en seleccionar y preparar una a una todas las piezas destinadas a formar el eje del motor.

La célula ensambla los elementos longitudinales uniendo una a una todas sus piezas con la ayuda de una herramienta especial; un capuchón en forma de taburete. Este "taburete" usa sus patas como pinzas para colocar una a una en su sitio correcto todas las piezas que se requieren para completar el eje.

Fases del proceso de construcción del motor

En la primera fase de construcción la célula fabrica una a una todas las piezas necesarias para formar un amillo llamado MS. Las piezas previamente fabricadas se ensamblan una a una hasta completar el anillo el cual queda firmemente encajado en la membrana de la célula.

A continuación la célula construye un segundo anillo (denominado anillo C). Dentro de este anillo se sitúa el aparato de exportación flagelar. Ahora todo está listo para el siguiente paso: la construcción del eje del motor.

Para poder cumplir su misión el aparato de exportación flagelar usa la fuerza del flujo de protones que penetran en la célula desde el exterior. Este aparato selecciona y prepara una a una todas las piezas destinadas a formar el eje del motor.

De esta forma la célula construye en un orden predeterminado 4 elementos del motor: (1) el eje central, (2) la junta universal, (3) la junta que une el codo con el filamento propulsor y (4) filamento el propulsor mismo.

El eje atraviesa la pared de la célula por el interior de un cojinete formado por dos anillos (llamados anillo L y anillo P) previamente construidos.

Tras haber completado su la tarea de construir el eje del motor este capuchón se desprende y la célula fabrica otro capuchón en forma de taburete. Este segundo taburete usa sus patas para construir pieza a pieza la junta universal o codo.

La misma operación se repite para construir la junta y el filamento.

CONCLUSIONES SOBRE LA CONSTRUCCIÓN DE MAQUINAS MOLECULARES

En resumen, los científicos han constatado que las células construyen sus motores siguiendo un procedimiento ordenado, un plan previamente determinado, que consiste en una serie de etapas que se ejecutan en un orden muy preciso.

La construcción de máquinas moleculares es un proceso en el que muchos elementos actúan como los músicos de una orquesta ejecutando al unísono una sinfonía, como si obedecieran las órdenes de un director invisible, como cumpliendo de un plan previamente concebido por un ingeniero que ha planeado de antemano todos los detalles, que ha diseñado los millones de tuercas, tornillos, muelles y rodamientos para que todos cooperen a conseguir un objetivo único.

EL ORIGEN DE LA INFORMACIÓN GENÉTICA

Para fabricar una máquina molecular la bacteria debe construir una a una todas las piezas. ¿Cómo se construye una pieza?

Todos los seres vivos, los leones, las arañas y las zanahorias, contienen en sus células las instrucciones necesarias para fabricar copias de sí mismos. Estas instrucciones se asemejan a una receta de cocina pues describen con todo detalle cómo debe construirse un ser vivo, entre otras cosas describen la forma tamaño y propiedades de cada uno de sus trillones de componentes (proteínas). Asimismo la bacteria posee en su interior unas instrucciones que indican a las distintas máquinas cómo deben fabricarse las piezas (llamadas proteínas).

ADN

La información necesaria para fabricar cada una de las proteínas se encuentra almacenada en una molécula llamada ADN. Esta molécula es una larga cadena de caracteres (A,C,G,T)

Transcripción

Para poder usar la información almacenada en el ADN la célula debe abrir la doble hélice. A continuación una máquina llamada polimerasa hace una copia de las instrucciones creando una cadena de ARN. Esta cadena de ARN sale del núcleo para ser introducida en otra máquina: el ribosoma.

Traducción

En el interior del Ribosoma se desarrolla un proceso llamado traducción que consiste en crear una cadena de aminoácidos que dará lugar a una proteína.

¿COMO SE ORIGINARON LAS MAQUINAS MOLECULARES?¿DISEÑO O EVOLUCION?

Existen dos posibles explicaciones sobre el origen de los Sistemas Biológicos tales como las máquinas moleculares. Estas explicaciones son (a) El Diseño y (b) La Evolución. ¿Cómo explican estas dos hipótesis el origen de las máquinas moleculares?

El origen de las máquinas moleculares según la Teoría de la Evolución

Charles Darwin escribió:

“Si se pudiese demostrar que existió un órgano complejo que no pudo haber sido formado por modificaciones pequeñas, numerosas y sucesivas, mi teoría se destruiría por completo; pero no puedo encontrar ningún caso de esta clase”

El origen de las especies, capítulo VI, apartado “Modos de transición”

Según la Teoría de la Evolución, el motor de la bacteria, el generador de energía ATP sintasa, el transportador Kinesina, y muchas otras sofisticadas máquinas micromoleculares son el resultado de la acumulación de "modificaciones pequeñas, numerosas y sucesivas", todas ellas surgidas accidentalmente. La primera de las piezas del motor apareció accidentalmente como resultado de una mutación (un error de copia). Esta primera pieza originada por un error de copia fue seleccionada por la Selección Natural de forma que las bacterias que contenían este error se reprodujeron más que las otras, hasta tal punto que las bacterias que no contenían error de copia llegaron a desaparecer. A continuación otra mutación (otro error de copia) causó por casualidad la aparición de la segunda pieza que casualmente encajaba perfectamente con la primera y así sucesivamente hasta completar el motor.

El origen de las máquinas moleculares según la Teoría del Diseño Inteligente

William Paley escribió:

“Al observar un reloj, …percibimos que sus varias partes están construidas y colocadas con un propósito, …que ha sido formadas y ajustadas para producir movimiento, y un movimiento tan preciso como para señalar la hora del día;.. El reloj tiene que haber tenido un relojero”

Según la Teoría del Diseño Inteligente, los motores complejos formados por cientos de piezas cuya forma y tamaño hacen que cooperen perfectamente para realizar una función que no podría ser alcanzada por ninguna de ellas individualmente, no surgen de errores de copia sino de una mente que concibe de antemano el funcionamiento final del motor y la forma, tamaño y función de cada una de las piezas del sistema con el objetivo de propulsar un objeto, generar energía o transportar una carga.

Preguntas sobre las máquinas moleculares

Tras haber observado en la célula la existencia de máquinas moleculares, y constatar que sólo existen dos explicaciones para su origen, ahora podemos reflexionar acerca de cuál de estas dos explicaciones es más razonable, es decir cuál de ellas explica mejor los hechos empíricos observados científicamente.

1. ¿Muestran las máquinas moleculares características propias de diseño?

Los objetos diseñados (un motor fuera borda, un programa informático) muestran características propias de la acción de un autor inteligente, por ejemplo la perfecta coordinación de sus distintos componentes para lograr una función. Observemos el funcionamiento de las máquinas moleculares y preguntémonos:

¿Muestran el motor bacteriano, la kinesia, el ATP sintasa y todas las demás máquinas moleculares características propias de un objeto diseñado, por ejemplo... una perfecta coordinación de sus distintos componentes para lograr una función?

Los evolucionistas afirman que ninguna de estas máquinas fue diseñada sino que todas ellas surgieron por procesos naturales; ¿Qué características observadas en las máquinas moleculares indican que son el resultado de mutaciones al azar?

¿Qué indica la presencia de máquinas automatizadas realizando coordinadamente tareas dentro de nuestras células? ¿Un origen espontáneo o un origen inteligente?

Siempre que observamos un sistema formado por varios componentes que cooperan en la consecución de un fin (como una ratonera o un motor), deducimos lógicamente que es el resultado de una acción inteligente.

¿Por qué no razonamos de la misma forma cuando observamos el funcionamiento de las máquinas moleculares que ejecutan las actividades necesarias para la vida de las células?

Richard Dawkins, profesor evolucionista de la Universidad de Oxford escribió:

"La biología es el estudio de cosas complicadas que tienen la apariencia de haber sido diseñadas con un propósito"

The Blind Watchmaker (El Relojero Ciego) , 1996, p. 1

Si los organismos vivos poseen una complejidad tal que aparentan haber sido diseñados y las máquinas moleculares son un buen ejemplo de ello, ¿Cómo saben los evolucionistas que la sofisticada maquinaria celular no es fruto de un plan o diseño previo?

La ciencia ha observado ciertas similitudes entre el funcionamiento de la maquinaria molecular de la célula y el de complejos sistemas diseñados por el hombre como por ejemplo el helicóptero. Cuando observamos un helicóptero deducimos que ha sido diseñado por un agente inteligente porque está compuesto por distintas piezas interdependientes que están dispuestas de forma que cooperan para la consecución de un fin que ninguna de ellas podría conseguir de forma aislada. Los distintos sistemas que forman el helicóptero obedecen a un plan preconcebido por una mente inteligente.

¿Muestran las máquinas celulares una disposición semejante a las máquinas diseñadas por ingenieros inteligentes? ¿Obedecen los distintos sistemas de una célula a un plan preconcebido por una mente inteligente?

2. ¿Muestran las máquinas moleculares evidencias de haberse originado “por numerosas pequeñas modificaciones sucesivas”?

¿Qué evidencia empírica podemos observar para comprobar que efectivamente estas máquinas se formaron como afirmó Darwin “por numerosas pequeñas modificaciones sucesivas” que cada una de ellas confirió al organismo una nueva ventaja reproductiva?

¿Cuál fue la primera “pequeña modificación” y por qué confirió al individuo que la poseía una ventaja reproductiva sobre sus hermanos? ¿Fue quizás el rotor la primera pieza que apareció a causa de una mutación? ¿Qué ventaja evolutiva confiere un rotor en ausencia del resto del sistema?

¿Cómo pudo la Selección Natural seleccionar una pieza que no iba a ser util hasta miles de generaciones más tarde?

Si las distintas piezas que forman las máquinas moleculares se fueron originando poco a poco ¿Por qué motivo la Selección Natural elegiría a individuos que poseyeran una parte de un futuro sistema, por ejemplo el rotor, si este rotor iba a permanecer inservible durante miles de generaciones a la espera de la llegada del resto de las piezas que iban a completar el motor? ¿Puede la Selección Natural seleccionar una pieza que no servirá para nada en ausencia del resto de las piezas del motor?

La selección natural sólo puede actuar sobre una funcionalidad completamente operativa. La ventaja reproductiva solo se alcanza si el sistema está completo porque solo el sistema funcionando en su totalidad confiere al organismo dicha ventaja.

¿Cómo es posible que una de las piezas de una futura máquina molecular, por sí sola, sea favorecida por la selección natural?

3. ¿Cómo funcionaban estas máquinas en el punto medio de su largo proceso evolutivo?

Suponiendo que la evolución del motor bacteriano fue un proceso que tuvo lugar a lo largo de muchas generaciones.

¿Cómo funcionaban el motor bacteriano y la kinesina y el motor ATP sintasa en el punto medio de su proceso evolutivo? ¿Disponían de todas las piezas a medio evolucionar o disponían de la mitad de las piezas completamente evolucionadas esperando a que evolucionara la otra mitad?

¿Qué ventaja evolutiva aporta a la bacteria un motor a medio evolucionar que no puede propulsarla o una kinesina a medio formar que no puede transportar cargas o un motor ATP sintasa a medio completar que no puede producir ATP?

4. ¿Evolucionó el primer sistema reproductor?

El primer ser vivo capaz de autoreproducirse tuvo, obviamente, un sistema reproductor completamente funcional, obviamente no pudo heredar su sistema reproductor de su progenitor pues el primer ser vivo no tuvo ningún progenitor…

¿Qué tipo de fenómeno tiene la capacidad de causar la existencia de un ser vivo provisto de un sistema reproductor completamente funcional?

En otras palabras...

¿Cómo llego a existir el más antiguo antepasado de los seres unicelulares, el primero que estaba equipado de sistema reproductor completamente funcional capaz de producir copias de sí mismo?

Los diversos sistemas reproductores observados en los organismos más pequeños son increíblemente complejos. El primer ser vivo que se reproducía por sí mismo tuvo necesariamente que formarse a partir de algo que no era un ser vivo y además tuvo que dejar descendencia antes de que su cuerpo se descompusiera.

¿Cómo se formó, por procesos naturales y sin intervención de ningún agente inteligente en el breve plazo de una generación, la maquinaria reproductora del primer ser vivo? ¿Era capaz de procrear el primer ser vivo que apareció en la Tierra?

Es decir...

¿Poseía un sistema reproductor completamente funcional?

Si lo tenía...

¿Cómo lo obtuvo? ¿Qué proceso o mecanismo natural dotó al primer ser vivo de un sistema reproductor completamente funcional para que no muriera sin dejar descendencia?

Si no estaba dotado de un sistema de reproducción completamente funcional...

¿Cómo se reprodujo?

5. ¿Evolucionó la información genética codificada?

El sustrato básico de la vida es la información. Todos los seres vivos poseemos en nuestras células información genética. El primer organismo vivo tuvo que poseer ya una ingente cantidad de información genética codificada. El problema del origen de la vida es el problema del origen de esa gran cantidad de información genética imprescindible para la vida.

En nuestra experiencia cotidiana...

¿De dónde surge la información y los sistemas que la procesan? ¿De fenómenos naturales o de agentes inteligentes?

Todas las observaciones científicas indican que la información codificada siempre procede de seres inteligentes. Sin embargo los evolucionistas pretenden que la información genética procede de procesos puramente naturales, mecanismos ciegos carentes de inteligencia.

¿Qué proceso natural genera información? ¿Qué suceso tuvo la capacidad de traer a la existencia información genética del primer organismo vivo? ¿Dónde se ha observado un proceso puramente natural que cree información codificada?

Los evolucionistas afirman que la información que rige la vida llegó a existir por procesos materiales, sin embargo la información posee una naturaleza inmaterial.

¿Cómo puede un proceso material producir algo de naturaleza inmaterial?

6. ¿Evolucionaron los sistemas de procesamiento de información?

Las células no son simples bolsas de protoplasma como Darwin creía sino sofisticadas fábricas en miniatura que exhiben una increíble complejidad biológica basada en intrincados sistemas de procesamiento de información codificada entre los que podemos destacar tres aspectos esenciales:

1/ Sistema de almacenamiento de información codificada.

2/ Sistema de máquinas para el proceso de la información digital para producir elementos funcionales.

3/ Uso de información organizada jerárquicamente para regular la expresión de otra información.

El primer organismo que vivió sobre la Tierra ya poseía estos tres elementos, de lo contrario no habría dejado descendencia. Además tuvo que adquirirlos simultáneamente puesto que uno de ellos aislado sería eliminado por la Selección Natural.

¿Qué fenómenos naturales tienen la capacidad de  causar el origen simultáneo de (1) La información codificada (2) La maquinaria necesaria para el proceso de la información codificada y (3) la organización jerárquica de la información?

Dado que la ciencia se basa en la observación...

¿Qué características observadas en la célula conducen a la conclusión de que los distintos sistemas de proceso de información biológica digitalizada se generaron espontáneamente?

7. ¿Surgió el código genético mediante evolución?

La información genética que rige la vida, al igual que este texto, está codificada usando elementos químicos (bases) que transmiten información de la misma forma que las letras, palabras y frases de los idiomas humanos.

El Código Genético usa un “abecedario” de 4 letras G,C,A,T. Con ellas los organismos vivos almacenan y transmiten mensajes que frecuentemente poseen una longitud de varios miles de letras. ( GCATTTGCAATGGCAATCGTA)

¿Puede surgir un sistema de codificación sin diseño inteligente? ¿Qué otro sistema de codificación ha existido sin un diseño inteligente?

Para descifrar la información genética los organismos vivos usan un código similar al código Morse.

Un sistema coordinado de robots en miniatura, denominados máquinas moleculares, agrupa las letras en bloques de tres GCA TTT GCA ATG GCA ATC GTA, a continuación traduce cada grupo en una letra de otro “abecedario” distinto del primero, compuesto esta vez por 20 letras (llamadas aminoácidos) y el resultado es una nueva secuencia: K-N-Q-Q-P-F-K-W-R-S-V-S-C-I-H-E-Y.

Esta nueva secuencia describe completamente la forma y propiedades de una de las piezas que forman nuestro cuerpo (una proteína).

¿Cómo consiguió la naturaleza, mediante errores de copia y selección natural, reunir miles de millones de bases (G,C,A,T) de forma que al agruparlas de tres en tres produzcan una descripción detallada de la forma, tamaño,  propiedades funcionales y emplazamiento exacto de todas las moléculas de todas la proteínas de todos los orgánulos de todas la células de todos los tejidos de todos los órganos de todos los seres vivos, consiguiendo un funcionamiento coordinado y armonioso de trillones de elementos que desde el nivel molecular al nivel orgánico cooperan armoniosamente en la consecución de un mismo fin?

Al observar un mensaje codificado en código Morse inmediatamente deducimos que fue originado en una mente.

¿Por qué un mensaje codificado según el Código Morse es evidencia de una fuente inteligente y un mensaje codificado según el Código Genético no lo es?

¿Qué nos indica la presencia de información codificada en la piedra de Roseta, en los jeroglíficos egipcios o en el programa SETI de búsqueda de inteligencia extraterrestre, origen inteligente u origen accidental?

¿Qué nos indica la presencia de información codificada en el interior de la célula, origen inteligente u origen accidental?

¿Por qué cuando encontramos información codificada nos parece lógico atribuirla a la acción de un agente inteligente y en el caso de la célula deberíamos atribuirla a fenómenos accidentales?

8. ¿Evolucionaron las instrucciones de montaje?

Todos los seres vivos, los leones, las arañas y las zanahorias, contienen en sus células todas las instrucciones necesarias para fabricar copias de sí mismos. Estas instrucciones se asemejan a una receta de cocina pues describen con todo detalle cómo debe construirse un ser vivo, entre otras cosas describen la forma tamaño y propiedades de cada uno de sus trillones de componentes (proteínas), describen cuántas proteínas son necesarias, en qué instante preciso deben fabricarse y cuándo y cómo deben ensamblarse exactamente.

¿Qué fenómeno natural crea instrucciones de ensamblaje y funcionamiento de un ser vivo con capacidad de hacer copias de sí mismo?

El ADN humano está formado por más de 3.000 millones de letras que incluyen instrucciones detalladas para formar, molécula a molécula, todo nuestro cuerpo.

¿Cómo han llegado a plasmarse por escrito estas instrucciones tan detalladas? ¿Por el azar o por la inteligencia?

Supongamos que en una excavación arqueológica en Mesopotamia descubriéramos una colección de tablillas cuneiformes que contuvieran una sucesión de millones de caracteres que agrupados de tres en tres codificaran un libro conteniendo las instrucciones de ensamblaje y funcionamiento de una maquinaria tan extremamente sofisticada como el cuerpo y la mente humanos.

Dado que estos caracteres representan las instrucciones de montaje de una maquinaria sofisticada...

¿Concluiríamos que estas instrucciones de montaje fueron producidas por fenómenos naturales como el viento, el agua o el impacto fortuito de otras rocas o por la acción de un agente inteligente?

Supongamos que simultáneamente un prestigioso equipo de investigadores descubre una molécula de ADN que contiene una sucesión de 3.000 millones de letras que al agruparlas de tres en tres codificaran un libro conteniendo las instrucciones de ensamblaje y funcionamiento de una maquinaria tan extremamente sofisticada como el cuerpo y la mente humanos.

Dado que estos caracteres representan las instrucciones de montaje de una maquinaria sofisticada...

¿Concluiríamos que estas instrucciones de montaje fueron producidas por fenómenos naturales como la electricidad o el magnetismo o por la acción de un agente inteligente?

El manual de instrucciones de un helicóptero evidencia de la acción de un agente inteligente.

¿Por qué la ingente e infinitamente más compleja información que recoge las instrucciones de ensamblaje y funcionamiento de todos los seres vivos del planeta escrita en un alfabeto de tan sólo 4 caracteres no es evidencia de inteligencia?

9. ¿Pudo una causa natural provocar el origen de la vida?

Aunque no conozcamos la causa exacta del origen de la vida podemos preguntarnos…

¿Fue una causa natural o una causa inteligente?

¿Puede una causa natural originar seres vivos?

¿Qué fenómenos puramente naturales poseen la capacidad de crear seres vivos a partir de la materia inerte sin intervención inteligente?

10. ¿Puede surgir un ser vivo de la unión de sus partes?

Un ser vivo no es la suma de sus componentes químicos. La experimentación científica demuestra que aunque se encuentren en un mismo lugar todas las moléculas que componen un organismo, éstas no se unen espontáneamente para formar un ser vivo.

Al tratar de explicar el origen de la vida las narraciones evolucionistas hacen que imaginemos que el primer ser vivo llegó a existir porque las distintas partes que formaban su cuerpo "se unieron" de forma fortuita dando como resultado un individuo plenamente funcional que antes de morir fue capaz de dejar descendencia.

¿Qué probabilidades hay de que al depositar en un mismo lugar todos los componentes de un ser vivo, por ejemplo una bacteria, obtengamos un individuo capacitado para reproducirse por sí mismo?

¿Puede la conjunción accidental de los componentes de un organismo crear un ser vivo?

¿Qué evidencia concreta se ha observado en los seres vivos que nos conduzca a creer que puede surgir un individuo vivo mediante la simple unión de sus partes?

11. ¿Dónde se ha observado la generación espontánea de la vida?

Dado que la ciencia se basa en la observación de la naturaleza.

¿En qué lugar de la naturaleza se ha observado un fenómeno natural que produzca seres vivos a partir de la materia inerte sin intervención inteligente?

Darwin propuso que el primer organismo viviente se formó en “un pequeño estanque caliente” donde el azar depositó una sopa primordial que contenía las substancias químicas necesarias para forman el cuerpo de nuestro antepasado más remoto.

¿Existe algún indicio empírico de que existió un estanque caliente o esa sopa primordial de la cual surgió el primer ser vivo?

En otras palabras, dado que la ciencia se basa en la observación...

¿Hemos observado ese estanque caliente o esa sopa primordial en algún lugar en concreto o es tan sólo parte de la imaginación evolucionista?

12. ¿Qué características de los seres vivos indican que se originaron espontáneamente?

La biología es la ciencia que estudia las características de los seres vivos. Razonando a partir de estas características podremos comprender las causas de su origen.

¿Poseen los seres vivos características de generación espontánea, es decir características que evidencien un origen basado en la autotransformación de materia inerte en seres vivos mediante mecanismos naturales?

Quienes niegan que la vida tenga un origen inteligente sostienen que la vida surgió de la materia. Si tal afirmación procede de la observación científica entonces…

¿Cuáles son las características observadas en los seres vivos que han conducido a quienes niegan el origen inteligente de la vida a concluir que la vida surgió espontáneamente a partir de la materia por mecanismos naturales?

Dado que el método científico se basa en la observación, la respuesta a esta pregunta debe ser una lista de características observables científicamente y no de opiniones tales como “los biólogos creen…”, o “la biología ha demostrado…” o escapatorias similares. Al responder es preciso diferenciar cuidadosamente observaciones e interpretaciones.

Tomemos el ser vivo más pequeño que existe, una bacteria, para examinarla detenidamente. Aumentémosla hasta que tome el tamaño de un avión. ¿Qué vemos? Una maravilla de la ingeniería. Un fabuloso mundo de máquinas moleculares, generadores de energía, motores, camiones, cadenas de montaje etc. que actúan coordinadas, al unísono, y que cumplen cada una su función precisa, como si cada máquina tuviera conocimiento de cuál es su misión en el sistema, como si todo hubiera sido programado de antemano.

La lógica y la razón y la observación científica nos indican que todo sistema complejo que requiere de todas sus partes para cumplir su función procede de una mente inteligente.

¿Por qué el sistema más complejo conocido, la célula, no procede de la inteligencia?

Una bacteria es muchísimo más compleja y sofisticada que un submarino.

¿Por qué motivo el diseño observado en un submarino es producto de la inteligencia y el diseño observado en una bacteria es fruto de un proceso carente de inteligencia?

Observando las características de la vida...

¿Qué razonamiento basado en estas características conduce a deducir que la vida se generó a si misma por procesos exclusivamente materiales no guiados por ninguna inteligencia?

¿Qué otro tipo de causa, que no sea la inteligencia, se ha observado que sea capaz de producir sistemas complejos?

13. ¿A partir de qué especie evolucionó la primera especie?

Una estrategia común entre los evolucionistas para evitar el espinoso problema del origen de la vida es usar el siguiente juego de palabras: “La evolución no trata del origen de la vida sino del origen de las especies”.

Pero esa excusa es una escapatoria inútil porque todos los seres vivos pertenecen a una especie y por lo tanto el primer ser vivo perteneció también a una especie. Si la evolución afirma que puede explicar el origen de las especies, debería empezar por la primera.

Existe incluso un nombre para esta hipotética primera especie; LUCA. Según Wikipedia:

El último antepasado común universal, conocido por sus siglas en inglés LUCA (Last Universal Common Ancestor) es el hipotético último organismo del cual descendemos todos los existentes... Se estima que vivió hace alrededor de 3.500 millones de años.

Wikipedia, 2011

Darwin escribió un libro titulado “El Origen de las Especies” en el que postulaba que las especies se originan mediante modificación de otras especies preexistentes. Si todas las especies evolucionaron a partir de otra especie …

¿A partir de qué especie evolucionó la primera especie?

14. ¿Dónde se ha observado evidencia de transición de la materia inerte al primer ser vivo?

Ante la imposibilidad científica de que la primera especie evolucionara, los defensores de la generación espontánea necesitan nuevas estrategias para defender sus creencias materialistas. Una de esas estrategias consiste en invocar la existencia de largos periodos de tiempo. La materia pues se transformó en seres vivos a través de un lento proceso gradual que duró miles de millones de años.

¿Existen evidencias observables de que tal proceso existió? ¿Existen evidencias de que el paso del tiempo contribuye a que la materia se transforme en seres vivos?

Si estos largos periodos de tiempo evolutivo hubieran existido debería haber habido una cadena ininterrumpida de innumerables formas transicionales entre la materia y la vida. La paleontología no aporta ninguna evidencia de estas formas intermedias. En el registro fósil encontramos trazas de organismos unicelulares, pero todos se encuentran completamente formados, no en proceso de formación.

¿Dónde están las evidencias de que en realidad existieron formas intermedias durante todos esos miles de millones de años?

15. ¿Evolucionó la complejidad especificada?

Aunque los evolucionistas pretendan que su teoría no se refiere al origen de la vida el mismo Darwin, en una carta escrita en 1871, especuló que la vida surgió por causas materiales. Esta explicación resultaba convincente para Darwin pues para él, como para todos los científicos de su época la célula era un simple globo de protoplasma.

Hoy la biología ha descubierto que la célula es una sofisticada obra de ingeniería compuesta por miles de sistemas complejos e interdependientes basados en el procesamiento automático de una gran masa de información codificada digitalmente.

Franklin M. Harold, evolucionista y profesor emérito de bioquímica en la Universidad Estatal de Colorado (EEUU) dice:

“Debemos reconocer que actualmente no existe ninguna descripción darwinista detallada de la evolución de ningún sistema bioquímico o celular, tan sólo una serie de especulaciones vacías”

Franklin M. Harold, The way of the cell: molecules, organisms and the order of life, Oxford University Press, New York, p. 205.

¿Cómo llegaron a existir los complejos sistemas intracelulares?

Todas las células estudiadas científicamente han resultado ser tremendamente complejas muchísimo más complejas que lo que Darwin y los creadores de la Teoría Sintética creían. Cuanto más profundo y detallado es un estudio científico, tanta más complejidad se observa. Más ciencia resulta en más complejidad.

¿Qué observación científica objetiva conduce a los evolucionistas a creen en la existencia remota de células simples?

Las células simples, las hadas y los elfos son seres imaginarios, ficticios, que no existen en el mundo real pues no hay ninguna constancia científica de la existencia de hadas, elfos o células simples.

La ciencia es una empresa que se basa en razonar a partir de observaciones comprobadas experimentalmente o hechos empíricos observados.

¿Qué observación científica o qué hecho empírico lleva a suponer que hubo una vez seres simples si lo único que observamos son seres complejos?

¿Cómo, a partir de la observación empírica de seres complejos, concluimos que proceden de la transformación de seres simples que jamás hemos observado?

¿Qué mecanismos naturales han causado la existencia de la complejidad biológica de las formas de vida más sencillas observadas por la ciencia?

Los organismos vivos exhiben una complejidad denominada complejidad especificada. El astrobiólogo Paul Davies en su libro The Fith Miracle (1999) asocia la complejidad especificada al problema del origen de la vida:

“Los organismos vivos son misteriosos no por su complejidad per se sino por su hermética complejidad especificada. Para comprender plenamente el surgimiento de la vida a partir de lo inanimado, tenemos que conocer no sólo el modo en que fue concentrada la información necesaria, sino saber también de qué manera llegó a ser especificada la información biológicamente útil.”

¿De qué modo llegó a concentrarse la información biológicamente útil del primer ser vivo?

¿Qué observación empírica nos lleva a concluir que la concentración de información se produjo mediante mecanismos naturales y no de forma inteligente?

¿Qué hecho concreto y observable nos indica que la información biológicamente útil se obtiene por procesos naturales?

TESTIMONIO CIENTÍFICO SOBRE EL ORIGEN DE LA VIDA

El Profesor Paul Davies, renombrado evolucionista, reconoce,

«Nadie sabe cómo una mezcla de sustancias químicas inertes se organizó de forma espontánea en la primera célula viva.»

Paul Davies, Centro Australiano de Astrobiología, “Born Lucky”New Scientist (vol. 179, July 12, 2003), p. 32.

Andrew Knoll, profesor de biología de la universidad de Harvard, dice:

“En realidad no sabemos cómo se originó la vida en este planeta”.

Entrevista How did life begin?

Para el gran científico Luis Pasteur la generación espontánea no es más que una creencia filosófica disfrazada de ciencia. Estas son sus palabras:

“¿Puede organizarse la materia por sí misma? En otros términos, ¿pueden venir los seres al mundo sin padres, sin ascendientes? He ahí la cuestión a resolver. Es preciso decirlo: la creencia en la generación espontánea ha sido una creencia de todas las edades; universalmente aceptada en la antigüedad, muy discutida en los tiempos modernos y sobre todo en nuestros días. Es esta creencia la que vengo a combatir”

Luis Pasteur, Conferencia en La Sorbona, 7 Abril 1864

Referencias : 
  1. La Bianchet, MA et al., El 2,8-una estructura de la F1-ATPasa de hígado de rata: Configuración de una hidrólisis críticos intermedios en la síntesis de ATP /, Proc. Nat. Acad. Sci. EE.UU. 95 (19) :11065-11070, 1998.
Temas Relacionados: 

Theme by Danetsoft and Danang Probo Sayekti inspired by Maksimer